Página 1 dos resultados de 21611 itens digitais encontrados em 0.039 segundos

‣ Nucleotide sequence, genomic organization and chromosome localization of 5S rDNA in two species of Curimatidae (Teleostei, Characiformes)

Santos, Lessandra Viviane de Rosa; Foresti, Fausto; Wasko, Adriane Pinto; Oliveira, Claudio; Martins, Cesar
Fonte: Sociedade Brasileira de Genética Publicador: Sociedade Brasileira de Genética
Tipo: Artigo de Revista Científica Formato: 251-256
Português
Relevância na Pesquisa
56.96435%
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP); Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq); Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES); The 5S ribosomal DNA (5S rDNA) of higher eukaryotes is organized in repeat units of tandem arrays composed of a 5S rDNA coding region, conserved even among non-related taxa, and a variable non-transcribed spacer sequence (NTS). To contribute to knowledge on the organization and evolution of vertebrate 5S rDNA we used PCR, nucleotide sequencing, Southern blot hybridization and chromosome fluorescence in situ hybridization (FISH) to investigate 5S rDNA tandem repeats in the South American Curimatidae fish Steindachnerina insculpta and Cyphocharax modesta. 5S rDNA repeats of 180 base pairs (bp) from both species were PCR-generated and sequenced evidencing the shortest 5S rDNA monomer so far described in eukaryote species. Southern blotting revealed that both species contained two tandem 5S rDNA classes, the PCR amplified fragment composed of 180 bp monomers and a class of 1600 bp monomers not detected by PCR. Chromosome mapping of the 5S rDNA repeats identified a major locus in both species and a second minor locus only in C. modesta. The Southern blot and chromosome mapping data indicate the presence of different types of 5S rDNA tandem repeats in the Curimatidae genome.

‣ Nucleotide sequence of 5S rDNA and localization of the ribosomal RNA genes to metaphase chromosomes of the Tilapiine cichlid fish, Oreochromis niloticus

Martins, Cesar; Wasko, Adriane P.; Oliveira, Claudio; Wright, Jonathan M.
Fonte: Universidade Estadual Paulista Publicador: Universidade Estadual Paulista
Tipo: Artigo de Revista Científica Formato: 39-46
Português
Relevância na Pesquisa
67.21562%
In this study, we report the cloning and nucleotide sequence of PCR-generated 5S rDNA from the Tilapiine cichlid fish, Oreochromis niloticus. Two types of 5S rDNA were detected that differed by insertions and/or deletions and base substitutions within the non-transcribed spacer (NTS). Two 5S rDNA loci were observed by fluorescent in situ hybridization (FISH) in metaphase spreads of tilapia chromosomes. FISH using an 18S rDNA probe and silver nitrate sequential staining of 5S-FISH slides showed three 18S rDNA loci that are not syntenic to the 5S rDNA loci.

‣ Nucleotide sequence, genomic organization and chromosome localization of 5S rDNA in two species of Curimatidae (Teleostei, Characiformes)

Santos,Lessandra Viviane de Rosa; Foresti,Fausto; Wasko,Adriane Pinto; Oliveira,Claudio; Martins,Cesar
Fonte: Sociedade Brasileira de Genética Publicador: Sociedade Brasileira de Genética
Tipo: Artigo de Revista Científica Formato: text/html
Publicado em 01/01/2006 Português
Relevância na Pesquisa
56.96435%
The 5S ribosomal DNA (5S rDNA) of higher eukaryotes is organized in repeat units of tandem arrays composed of a 5S rDNA coding region, conserved even among non-related taxa, and a variable non-transcribed spacer sequence (NTS). To contribute to knowledge on the organization and evolution of vertebrate 5S rDNA we used PCR, nucleotide sequencing, Southern blot hybridization and chromosome fluorescence in situ hybridization (FISH) to investigate 5S rDNA tandem repeats in the South American Curimatidae fish Steindachnerina insculpta and Cyphocharax modesta. 5S rDNA repeats of 180 base pairs (bp) from both species were PCR-generated and sequenced evidencing the shortest 5S rDNA monomer so far described in eukaryote species. Southern blotting revealed that both species contained two tandem 5S rDNA classes, the PCR amplified fragment composed of 180 bp monomers and a class of 1600 bp monomers not detected by PCR. Chromosome mapping of the 5S rDNA repeats identified a major locus in both species and a second minor locus only in C. modesta. The Southern blot and chromosome mapping data indicate the presence of different types of 5S rDNA tandem repeats in the Curimatidae genome.

‣ Nucleotide sequence changes in thymidine kinase gene of herpes simplex virus type 2 clones from an isolate of a patient treated with acyclovir.

Kit, S; Sheppard, M; Ichimura, H; Nusinoff-Lehrman, S; Ellis, M N; Fyfe, J A; Otsuka, H
Fonte: PubMed Publicador: PubMed
Tipo: Artigo de Revista Científica
Publicado em /10/1987 Português
Relevância na Pesquisa
47.398555%
To identify the nucleotide changes that occur in drug-induced thymidine kinase (TK) mutants of herpes simplex virus type 2 (HSV-2), we compared the nucleotide sequences of the tk genes of two mutant HSV-2 clones isolated from a patient who had been treated with acyclovir [9-(2-hydroxyethoxymethyl)guanine; ACV] with the nucleotide sequence of the parental TK+ HSV-2(8703) strain isolated from the same patient. One of the mutants, TK-altered (TKA) HSV-2(9637), was ACV resistant but induced the incorporation of [14C]thymidine into the DNA of infected rabbit skin cells. The nucleotide sequence of the tk gene of mutant TKA HSV-2(9637) had a single change (G to A) at nucleotide 668, which would cause an arginine-to-histidine substitution at amino acid residue 223 of the TK polypeptide. The second ACV-resistant mutant, TK- HSV-2(8710), did not induce detectable incorporation of [14C]thymidine into the DNA of infected rabbit skin cells. This mutant exhibited a deletion of a single base at nucleotide 217 of its nucleotide sequence. This deletion would cause a frameshift mutation at amino acid residue 73 and chain termination at amino acid residue 86 of the TK polypeptide. The nucleotide sequence of TK+ HSV-2(8703) was the same as that of the laboratory strain...

‣ Nucleotide sequence comparisons of plasmids pHD131, pJB1, pFA3, and pFA7 and beta-lactamase expression in Escherichia coli, Haemophilus influenzae, and Neisseria gonorrhoeae.

Chen, S T; Clowes, R C
Fonte: PubMed Publicador: PubMed
Tipo: Artigo de Revista Científica
Publicado em /07/1987 Português
Relevância na Pesquisa
47.31586%
The sites of initiation for beta-lactamase mRNA transcription and the nucleotide sequences of beta-lactamase plasmids derived from Haemophilus and Neisseria species were determined. In N. gonorrhoeae, transcription from plasmid pFA3 was initiated from two sites, one located about 20 base pairs (bp) and the other 210 bp upstream of the beta-lactamase initiating codon, whereas in H. influenzae, transcriptional initiation from plasmid pHD131 occurred at two different sites, approximately 150 and 170 bp upstream of the initiating codon. When these plasmids were transformed into Escherichia coli, transcription was initiated at the 150- and 170-bp upstream sites in both plasmids. The nucleotide sequences of both plasmids within the noncoding region upstream of the transcriptional initiation site were identical and, except at two or three nucleotide positions, the sequences were also identical to the corresponding region of Tn3. At one of these positions there is a TA for CG substitution, which correlates in E. coli and Haemophilus sp. with the presence of two strong, overlapping beta-lactamase promoters, initiating transcription at the 150- and 170-bp upstream sites. Over a larger (875-bp) segment comprising most of the sequences of the tnpR and bla genes...

‣ Complete nucleotide sequence of an Amerindian human T-cell lymphotropic virus type II (HTLV-II) isolate: identification of a variant HTLV-II subtype b from a Guaymi Indian.

Pardi, D; Switzer, W M; Hadlock, K G; Kaplan, J E; Lal, R B; Folks, T M
Fonte: PubMed Publicador: PubMed
Tipo: Artigo de Revista Científica
Publicado em /08/1993 Português
Relevância na Pesquisa
47.323525%
The complete nucleotide sequence of a human T-cell lymphotropic virus type II (HTLV-II) isolate from a Panamanian Guaymi Indian was determined and analyzed. When this new viral isolate (HTLV-IIG12) was compared with prototypic HTLV-IIMoT, the overall nucleotide sequence similarity was 95.4%, while the predicted amino acid sequence similarity was 97.5%. Although the overall percentage of nucleotide and amino acid identity with prototypic HTLV-IIMoT (subtype a) was high, HTLV-IIG12 displayed several distinctive features that defined it as an HTLV-II subtype b. However, there were several characteristics unique to this isolate, which included a cluster of nucleotide substitutions in the pre-gag region and changes in restriction enzyme sites within the pre-gag region and the gag, pol, env, and pX genes. In addition, two nucleotide changes in the C terminus of the Tax protein coding sequence inserted an Arg residue for a stop codon and appeared to result in a larger tax gene product in HTLV-IIG12. Although the HTLV-IIG12 isolate appears to be a variant of the prototypic HTLV-IIb, this information represents the first complete nucleotide sequence of any HTLV-II subtype b. These data will allow further studies on the evolutionary relationships between the HTLV-II subtypes and between HTLV-I and HTLV-II.

‣ Nucleotide sequence of bacteriophage f1 DNA.

Hill, D F; Petersen, G B
Fonte: PubMed Publicador: PubMed
Tipo: Artigo de Revista Científica
Publicado em /10/1982 Português
Relevância na Pesquisa
47.3499%
The nucleotide sequence of the DNA of the filamentous coliphage f1 has been determined. In agreement with earlier conclusions, the genome was found to comprise 6,407 nucleotides, 1 less than that of the related phage fd. Phage f1 DNA differs from that of phage M13 by 52 nucleotide changes, which lead to 5 amino acid substitutions in the corresponding proteins of the two phages, and from phage fd DNA by 186 nucleotide changes (including the single-nucleotide deletion), which lead to 12 amino acid differences between the proteins of phages f1 and fd. More than one-half of the nucleotide changes in each case are found in the sequence of 1,786 nucleotides comprising gene IV and the major intergenic region between gene IV and gene II. The sequence of this intergenic region (nucleotides 5501 to 6005) of phage f1 differs from the sequence reported by others through the inclusion of additional single nucleotides in eight positions and of a run of 13 nucleotides between positions 5885 and 5897, a point of uncertainty in the earlier published sequence. The differences between the sequence of bacteriophage f1 DNA now presented and a complete sequence for the DNA previously published by others are discussed, and the f1 DNA sequence is compared with those of bacteriophages M13 and fd.

‣ A conserved nucleotide sequence, coding for a segment of the C-propeptide, is found at the same location in different collagen genes.

Yamada, Y; Kühn, K; de Crombrugghe, B
Fonte: PubMed Publicador: PubMed
Tipo: Artigo de Revista Científica
Publicado em 11/05/1983 Português
Relevância na Pesquisa
47.292695%
The nucleotide sequence of a segment of the chick alpha 1 type III collagen gene which codes for the C-propeptide was determined and compared with the corresponding sequence in the alpha 1 type I and alpha 2 type I collagen genes. As in the alpha 2 type I gene the coding information for the C-propeptide of the type III collagen gene is subdivided in four exons. Similarly, the amino proximal exon contains sequences for both the carboxy terminal end of the alpha-helical segment of collagen and for the beginning of the C-propeptide in both genes. Therefore, this organization of exons must have been established before these two collagen genes arose by duplication of a common ancestor. In several subsegments the deduced amino acid sequence for the C-propeptide of type III collagen shows a strong homology with the corresponding amino acid sequence in alpha 1 and alpha 2 type I. For one of these homologous amino acid sequences, however, the nucleotide sequence is much better conserved than for the others. It is possible that a mechanism of gene conversion has maintained the homogeneity of this nucleotide sequence among the interstitial collagen genes. Alternatively, the conserved nucleotide sequence may represent a regulatory signal which could function either in the DNA or in the RNA.

‣ Requirement of multiple copies of a 21-nucleotide sequence in the U3 regions of human T-cell leukemia virus type I and type II long terminal repeats for trans-acting activation of transcription.

Shimotohno, K; Takano, M; Teruuchi, T; Miwa, M
Fonte: PubMed Publicador: PubMed
Tipo: Artigo de Revista Científica
Publicado em /11/1986 Português
Relevância na Pesquisa
47.307866%
The cis-acting regulatory sequence of transcription from long terminal repeats (LTRs) of human T-cell leukemia virus type I and type II (HTLV-I and HTLV-II), which is essential for action of the virally encoded trans-acting transcriptional factor(s) designated pX(s), in HTLV-I and -II was identified. Deletion of most of the U3 region of the HTLV-I LTR resulted in loss of trans-acting transcriptional activation. However, when a tandem repeat of a 21-nucleotide sequence (GAAGGCTCTGACGTCTCCCCC) that is present in the U3 region of HTLV-I and -II LTRs was inserted into the deleted U3 region of the HTLV-I LTRs, chloramphenicol acetyltransferase activity was restored. The extent of restoration of activity was proportional to the number of copies of the sequence inserted. To test the possibility that the 21-nucleotide sequence alone is necessary for trans-activation, a sequence (AGGAACTGAAA) homologous to a type-specific viral enhancer sequence and present in the U3 region of HTLV-II LTR, but not in the same region of the HTLV-I LTR, was inserted together with the 21-nucleotide sequence into the deleted U3 region of the HTLV-I LTR. However, no significant differences of the levels of activities of those LTRs compared to the LTRs with only the 21-nucleotide sequence repeats were observed.

‣ The EMBL Nucleotide Sequence Database

Kanz, Carola; Aldebert, Philippe; Althorpe, Nicola; Baker, Wendy; Baldwin, Alastair; Bates, Kirsty; Browne, Paul; van den Broek, Alexandra; Castro, Matias; Cochrane, Guy; Duggan, Karyn; Eberhardt, Ruth; Faruque, Nadeem; Gamble, John; Diez, Federico Garcia
Fonte: Oxford University Press Publicador: Oxford University Press
Tipo: Artigo de Revista Científica
Português
Relevância na Pesquisa
47.33473%
The EMBL Nucleotide Sequence Database (http://www.ebi.ac.uk/embl), maintained at the European Bioinformatics Institute (EBI) near Cambridge, UK, is a comprehensive collection of nucleotide sequences and annotation from available public sources. The database is part of an international collaboration with DDBJ (Japan) and GenBank (USA). Data are exchanged daily between the collaborating institutes to achieve swift synchrony. Webin is the preferred tool for individual submissions of nucleotide sequences, including Third Party Annotation (TPA) and alignments. Automated procedures are provided for submissions from large-scale sequencing projects and data from the European Patent Office. New and updated data records are distributed daily and the whole EMBL Nucleotide Sequence Database is released four times a year. Access to the sequence data is provided via ftp and several WWW interfaces. With the web-based Sequence Retrieval System (SRS) it is also possible to link nucleotide data to other specialist molecular biology databases maintained at the EBI. Other tools are available for sequence similarity searching (e.g. FASTA and BLAST). Changes over the past year include the removal of the sequence length limit, the launch of the EMBLCDSs dataset...

‣ Complete nucleotide sequence of a functional class I HLA gene, HLA-A3: implications for the evolution of HLA genes.

Strachan, T; Sodoyer, R; Damotte, M; Jordan, B R
Fonte: PubMed Publicador: PubMed
Tipo: Artigo de Revista Científica
Publicado em /04/1984 Português
Relevância na Pesquisa
47.384824%
The complete nucleotide sequence of an active class I HLA gene, HLA-A3, has been determined. This sequence, together with that obtained for the HLA-CW3 gene, represents the first complete nucleotide sequence to be determined for functional class I HLA genes. The gene organisation of HLA-A3 closely resembles that of class I H-2 genes in mouse: it shows a signal exon, three exons encoding the three extracellular domains, one exon encoding the transmembrane region and three exons encoding the cytoplasmic domain. The complete nucleotide sequences of the active HLA genes, HLA-A3 and HLA-CW3, now permit a meaningful comparison of the nucleotide sequences of class I HLA genes by alignment with the sequence established for a HLA-B7-specific cDNA clone and the sequences of two HLA class I pseudogenes HLA 12.4 and LN- 11A . The comparisons show that there is a non-random pattern of nucleotide differences in both exonic and intronic regions featuring segmental homologies over short regions, which is indicative of a gene conversion mechanism. In addition, analysis of the frequency of nucleotide substitution at the three base positions within the codons of the functional genes HLA-A3, HLA-B7 and HLA-CW3 shows that the pattern of nucleotide substitution in the exon coding for the 3rd extracellular domain is consistent with strong selection pressure to conserve the sequence. The distribution of nucleotide variation in the other exons specifying the mature protein is nearly random with respect to the frequencies of substitution at the three nucleotide positions of their codons. The evolutionary implications of these findings are discussed.

‣ Nucleotide Sequence-Based Analysis for Determining the Molecular Epidemiology of Penicillium marneffei

Lasker, Brent A.
Fonte: American Society for Microbiology Publicador: American Society for Microbiology
Tipo: Artigo de Revista Científica
Publicado em /09/2006 Português
Relevância na Pesquisa
47.323525%
The dimorphic fungus, Penicillium marneffei, is an emerging opportunistic pathogen endemic in Southeast Asia, especially for those with impaired cellular immunity such as human immunodeficiency virus-infected persons. A discriminatory and reproducible method based on the analysis of nucleotide sequences would facilitate epidemiologic investigations of this fungus. Twenty-four clinical or environmental isolates of P. marneffei obtained from China, Thailand, and Vietnam were analyzed by nucleotide sequence analysis. A total of 3,803 bp, consisting of eight nuclear gene fragments (transcription factor [AbaA], catalase [CpeA]], homodomain transcription factor [StlA], isocitrate lyase [Icl1], polyaromatic amino acid biosynthesis [PAA], NADH-dependent glutamate synthase [NGS], lovastatin nonaketide synthase [LNS], a cell wall mannoprotein [MP1], and a gene fragment of the cytochrome oxidase subunit 1 gene [COX1] of the P. marneffei mitochondrial genome) were amplified by PCR and then sequenced. No polymorphic sites within the Cox1 gene fragment were observed. Likewise, no nucleotide sequence polymorphisms were observed for three gene fragments: StlA, AbaA, and NGS. Seven single-nucleotide polymorphisms were observed for three gene fragments...

‣ Nucleotide sequence and genome organization of Dweet mottle virus and its relationship to members of the family Betaflexiviridae

Hajeri, Subhas; Ramadugu, Chandrika; Keremane, Manjunath; Vidalakis, Georgios; Lee, Richard
Fonte: Springer Vienna Publicador: Springer Vienna
Tipo: Artigo de Revista Científica
Português
Relevância na Pesquisa
56.824736%
The nucleotide sequence of Dweet mottle virus (DMV) was determined and compared to sequences of members of the families Alphaflexiviridae and Betaflexiviridae. The DMV genome has 8,747 nucleotides (nt) excluding the 3′ poly-(A) tail. DMV genomic RNA contains three putative open reading frames (ORFs) and untranslated regions of 73 nt at the 5′ and 541 nt at 3′ termini. ORF1 potentially encoding a 227.48-kDa polyprotein, which has methyltransferase, oxygenase, endopeptidase, helicase, and RNA-dependent RNA polymerase (RdRP) domains. ORF2 encodes a movement protein of 40.25 kDa, while ORF3 encodes a coat protein of 40.69 kDa. Protein database searches showed 98–99% matches of DMV ORFs with citrus leaf blotch virus (CLBV) sequences. Phylogenetic analysis based on the RdRP core domain revealed that DMV is closely related to CLBV as a member of the genus Citrivirus. DMV did not satisfy the molecular criteria for demarcation of an independent species within the genus Citrivirus, family Betaflexiviridae, and hence, DMV can be considered a CLBV isolate.

‣ Complete nucleotide sequence of a strain of cherry mottle leaf virus associated with peach wart disease in peach

Mekuria, Tefera A.; Druffel, Keri L.; Susaimuthu, James; Eastwell, Kenneth C.
Fonte: Springer Vienna Publicador: Springer Vienna
Tipo: Artigo de Revista Científica
Português
Relevância na Pesquisa
56.88992%
The complete nucleotide sequence and genome organization of a peach virus isolate from a naturally infected peach tree showing typical peach wart-like symptoms on the fruit surface was determined and compared to sequences of members of the family Betaflexiviridae. The genome consists of 7,987 nucleotides, excluding the poly-A tail, and has four open reading frames (ORFs). Analysis of the whole genome and putative proteins encoded by each ORF revealed greatest sequence similarity to a cherry isolate of cherry mottle leaf virus (CMLV). The two isolates have similar genome organizations and share 88 and 93 % homology in their corresponding products of the replicase and coat protein genes, respectively. CMLV has been reported from several Prunus spp. and may be associated with peach wart-like disease symptoms on peach fruit.

‣ Nucleotide sequence diversity of HLA class II genes in Australian Aborigines and populations of Asia-Oceania

Gao, Xiaojiang
Fonte: Universidade Nacional da Austrália Publicador: Universidade Nacional da Austrália
Tipo: Thesis (PhD)
Português
Relevância na Pesquisa
67.259854%
The aim of this thesis was to investigate nucleotide sequence diversity of HLA class II genes in Australian Aborigines and indigenous peoples of Asia-Oceania. Nineteen study populations represented eight major ethnic groups including Australian Aborigines, Papua New Guinean highlanders, coastal Melanesians, Polynesians, Micronesians, Javanese, southern and northern Chinese, and a minority group from northwestern China. Using PCR-based technologies, the nucleotide sequence polymorphism in exon 2 DRB1, DRB3, DRB5, DQA1 and DQB1 genes was examined in all these populations. The DPB1 exon 2 polymorphism was examined in Australian Aborigines and a Chinese population. Six novel HLA class II alleles including four DRB1, one DRB5 and one DPBl were discovered in this study by the occurrence of unusual hybridization patterns in the PCR-SSO typing procedure and were confirmed by DNA Sequencing. These new alleles, DRB1*0412, 1408, 1409, 1410, DRB5*0203 and DBP1*2201 have been recognized by the WHO Nomenclature Committee. The nucleotide sequences and the deduced amino acid sequences of the novel class II alleles indicated that multiple molecular mechanisms were involved in generating these alleles including point mutation and hypermutational events of segmental transfer and intra-exonic recombination. In two cases (DRB1*0412 and DRB1*1410)...

‣ A putative pathway for biosynthesis of the O-antigen component, 3-deoxy-L-glycero-tetronic acid, based in the nucleotide sequence of the Vibrio cholerae O1 rfb region

Morona, R.; Karageorgos, L.; Manning, P.; Stroeher, U.
Fonte: Elsevier Publicador: Elsevier
Tipo: Artigo de Revista Científica
Publicado em //1995 Português
Relevância na Pesquisa
57.024126%
The nucleotide sequence of a region of the rfb genes, encoding biosynthesis of the Vibrio cholerae (Vc) O1 O-antigen, was determined. Analysis of the open reading frames (ORFs) within this region has revealed similarities with a number of different classes of biosynthetic proteins and enzymes. The ORFs have been designated RfbK, RfbL, RfbM, RfbN and RfbO. RfbK is a small, acidic protein which has similarity to the family of proteins known as acyl-carrier proteins (ACP). The RfbL protein has similarity to a super-family of enzymes which adenylate their substrates as a part of their reaction mechanism. Included in these are several acetyl-CoA ligases. Alignment of RfbL with these proteins reveals a highly conserved domain containing the motif GlyXaaXaaGlyXaaPro. This resembles the ATP-binding site motif and may represent a variant of the usual motif, except that Pro replaces Gly. The VcRfbM protein has similarity with a family of long-chain, iron-containing alcohol dehydrogenases, of which the Escherichia coli K-12 fucO and adhE gene products are also members. The RfbN protein has sequence homology with LuxE and LuxC of Vibrio harveyi (Vh) and other bioluminescent bacterial species. The latter are two components of the enzyme complex which synthesizes the long-chain aldehyde used in the V. harveyi bioluminescence system. Finally...

‣ Nucleotide sequence diversity in Velvet tobacco mottle virus: a virus with a unique Australian pathosystem

Arthur, K.; Collins, N.; Yazarlou, A.; Randles, J.
Fonte: Kluwer Academic Publ Publicador: Kluwer Academic Publ
Tipo: Artigo de Revista Científica
Publicado em //2014 Português
Relevância na Pesquisa
57.10559%
Velvet tobacco mottle virus (VTMoV) is a naturally occurring mirid-transmitted sobemovirus of native velvet tobacco (Nicotiana velutina) plants in the Australian arid zone. We have sequenced the coding region of a typical field isolate of VTMoV (isolate I-17-04, satellite-plus) and show that it differed by nine polymorphisms from the previously sequenced atypical ‘satellite-minus’ variant VTMoV-K1 (represented here as L-K1-04), while retaining the same genomic and amino acid sequence motifs. We also report that although L-K1-04 was confirmed to be free of detectable satellite RNA by gel electrophoretic assay, the satellite sequence was detected in it by RT-PCR assay. Nucleotide sequence variation among the RNA-dependent RNA polymerase open reading frames of 15 field and laboratory isolates identified four phylogenetic groups, but these did not show a pattern related to site or time of sampling. This result would be consistent with nucleotide sequence variants of VTMoV being dispersed widely by migrating adult mirid vectors.; K. Arthur, N. C. Collins, A. Yazarlou, J. W. Randles

‣ Nucleotide sequence of AKV murine leukemia virus.

Herr, W
Fonte: PubMed Publicador: PubMed
Tipo: Artigo de Revista Científica
Publicado em /02/1984 Português
Relevância na Pesquisa
47.292695%
AKV is an endogenous, ecotropic murine leukemia virus that serves as one of the parents of the recombinant; oncogenic mink cell focus-forming viruses that arise in preleukemic AKR mice. I report the 8,374-nucleotide-long sequence of AKV, as determined from the infectious molecular clone AKR-623. The 5'-leader sequence of AKV extends to nucleotide 639, after which lies a long open reading frame encoding the gag and pol gene products. The reading frame is interrupted by a single amber codon separating the gag and pol genes. The pol gene overlaps the env gene within the 3' region of the AKV genome. The nucleotide sequence of the 5' region of AKV reveals the following features. (i) The 5'-leader sequence lacks any AUG codon to initiate translation of gPr80gag, suggesting that gPr80gag is not required for the replication of AKV. (ii) A short portion of the leader region diverges in sequence from the closely related Moloney murine leukemia virus and appears to be related to a sequence highly repeated in eucaryotic genomes. (iii) As in Moloney murine leukemia virus, there is a potential RNA secondary structure flanking the amber codon that separates the gag and pol genes. This structure might function as a regulatory protein binding site that controls the relative levels of synthesis of the gag and pol precursors. The nucleotide sequence of the 3' region of AKV is compared with sequences reported previously from both infectious and noninfectious molecular clones of AKV.

‣ Nucleotide sequence analysis establishes the role of endogenous murine leukemia virus DNA segments in formation of recombinant mink cell focus-forming murine leukemia viruses.

Khan, A S
Fonte: PubMed Publicador: PubMed
Tipo: Artigo de Revista Científica
Publicado em /06/1984 Português
Relevância na Pesquisa
47.31586%
The sequence of 363 nucleotides near the 3' end of the pol gene and 564 nucleotides from the 5' terminus of the env gene in an endogenous murine leukemia viral (MuLV) DNA segment, cloned from AKR/J mouse DNA and designated as A-12, was obtained. For comparison, the nucleotide sequence in an analogous portion of AKR mink cell focus-forming (MCF) 247 MuLV provirus was also determined. Sequence features unique to MCF247 MuLV DNA in the 3' pol and 5' env regions were identified by comparison with nucleotide sequences in analogous regions of NFS -Th-1 xenotropic and AKR ecotropic MuLV proviruses. These included (i) an insertion of 12 base pairs encoding four amino acids located 60 base pairs from the 3' terminus of the pol gene and immediately preceding the env gene, (ii) the deletion of 12 base pairs (encoding four amino acids) and the insertion of 3 base pairs (encoding one amino acid) in the 5' portion of the env gene, and (iii) single base substitutions resulting in 2 MCF247 -specific amino acids in the 3' pol and 23 in the 5' env regions. Nucleotide sequence comparison involving the 3' pol and 5' env regions of AKR MCF247 , NFS xenotropic, and AKR ecotropic MuLV proviruses with the cloned endogenous MuLV DNA indicated that MCF247 proviral DNA sequences were conserved in the cloned endogenous MuLV proviral segment. In fact...

‣ Fliih, the murine homologue of the Drosophila melanogaster flightless I gene: nucleotide sequence, chromosomal mapping and overlap with L1g1h

Campbell, Hugh; Fountain, S; Young, I M; Weitz, S; Lichter, Peter; Hoheisel, Jorg
Fonte: Harwood Academic Publishers Publicador: Harwood Academic Publishers
Tipo: Artigo de Revista Científica
Português
Relevância na Pesquisa
67.191504%
The Drosophila melanogaster flightless I gene is involved in cellularization processes in early embryogenesis and in the structural organization of indirect flight muscle. The encoded protein contains a gelsolin-like actin binding domain and an N-terminal leucine-rich repeat protein-protein interaction domain. We have cloned Fliih, the corresponding chromosomal gene from the mouse, and determined its nucleotide sequence (15.6 kb). The predicted Fliih protein of 1271 amino acids is 95% identical to the human FLII protein. Like the human gene, Fliih has 29 introns, compared with 13 in C. elegans and 3 in D. melanogaster. Fluorescence in situ hybridization was used to map Fliih to Chromosome 11B. Fliih lies adjacent to Llglh, the mouse homologue of the D. melanogaster tumor suppressor gene lethal(2) giant larvae. The sequence of the genomic DNA in this area, combined with cDNA sequences, establishes that the 3′ ends of the FIiih and Llglh transcripts overlap. The overlap region contains poIyA signals for both genes and is conserved between human and mouse.